Product Details

SNP ID
rs199951157
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.10:73499085 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGGAGTTGTCTGTTCTGGAGCGATG[C/G]GGGAGGCTCTGGTAGTTCAAAGTCC
Phenotype
MIM: 114106
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
PPP3CB PubMed Links

Gene Details

Gene
PPP3CB
Gene Name
protein phosphatase 3 catalytic subunit beta
There are no transcripts associated with this gene.

Gene
PPP3CB-AS1
Gene Name
PPP3CB antisense RNA 1 (head to head)
There are no transcripts associated with this gene.

Gene
USP54
Gene Name
ubiquitin specific peptidase 54
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001320437.1 4503 Silent Mutation CCC,CCG P1471P NP_001307366.1
NM_001320441.1 4503 Intron NP_001307370.1
NM_152586.3 4503 Silent Mutation CCC,CCG P1533P NP_689799.3
XM_005269582.2 4503 Silent Mutation CCC,CCG P1429P XP_005269639.1
XM_011539368.2 4503 Silent Mutation CCC,CCG P1498P XP_011537670.1
XM_017015759.1 4503 Silent Mutation CCC,CCG P1557P XP_016871248.1
XM_017015760.1 4503 Silent Mutation CCC,CCG P1557P XP_016871249.1
XM_017015761.1 4503 Silent Mutation CCC,CCG P1557P XP_016871250.1
XM_017015762.1 4503 Silent Mutation CCC,CCG P1557P XP_016871251.1
XM_017015763.1 4503 Silent Mutation CCC,CCG P1557P XP_016871252.1
XM_017015764.1 4503 Silent Mutation CCC,CCG P1557P XP_016871253.1
XM_017015765.1 4503 Silent Mutation CCC,CCG P1557P XP_016871254.1
XM_017015766.1 4503 Silent Mutation CCC,CCG P1557P XP_016871255.1
XM_017015767.1 4503 Silent Mutation CCC,CCG P1557P XP_016871256.1
XM_017015768.1 4503 Silent Mutation CCC,CCG P1557P XP_016871257.1
XM_017015769.1 4503 Silent Mutation CCC,CCG P1557P XP_016871258.1
XM_017015770.1 4503 Silent Mutation CCC,CCG P1557P XP_016871259.1
XM_017015771.1 4503 Silent Mutation CCC,CCG P1555P XP_016871260.1
XM_017015772.1 4503 Silent Mutation CCC,CCG P1552P XP_016871261.1
XM_017015773.1 4503 Silent Mutation CCC,CCG P1535P XP_016871262.1
XM_017015774.1 4503 Silent Mutation CCC,CCG P1533P XP_016871263.1
XM_017015775.1 4503 Silent Mutation CCC,CCG P1533P XP_016871264.1
XM_017015776.1 4503 Silent Mutation CCC,CCG P1533P XP_016871265.1
XM_017015777.1 4503 Silent Mutation CCC,CCG P1533P XP_016871266.1
XM_017015778.1 4503 Silent Mutation CCC,CCG P1517P XP_016871267.1
XM_017015779.1 4503 Silent Mutation CCC,CCG P1510P XP_016871268.1
XM_017015780.1 4503 Silent Mutation CCC,CCG P1505P XP_016871269.1
XM_017015781.1 4503 Silent Mutation CCC,CCG P1500P XP_016871270.1
XM_017015782.1 4503 Silent Mutation CCC,CCG P1493P XP_016871271.1
XM_017015783.1 4503 Silent Mutation CCC,CCG P1476P XP_016871272.1
XM_017015784.1 4503 Silent Mutation CCC,CCG P1476P XP_016871273.1
XM_017015785.1 4503 Silent Mutation CCC,CCG P1470P XP_016871274.1
XM_017015786.1 4503 Silent Mutation CCC,CCG P1436P XP_016871275.1

View Full Product Details