Product Details

SNP ID: rs201539553
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:100233365 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATTAAGGATGGCTTCACTGGCCAG[C/G]ACCTCCCTGCAGAAATAGCACAAAG
Phenotype: MIM: 600664 MIM: 616120 MIM: 611330
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CHUK PubMed Links

Gene Details

Gene: CHUK
Gene Name: conserved helix-loop-helix ubiquitous kinase

There are no transcripts associated with this gene.

Gene: CWF19L1
Gene Name: CWF19-like 1, cell cycle control (S. pombe)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303404.1	1567	Silent Mutation	GTC,GTG	V453V	NP_001290333.1
NM_001303405.1	1567	Silent Mutation	GTC,GTG	V356V	NP_001290334.1
NM_001303406.1	1567	Silent Mutation	GTC,GTG	V356V	NP_001290335.1
NM_001303407.1	1567	Silent Mutation	GTC,GTG	V248V	NP_001290336.1
NM_018294.5	1567	Silent Mutation	GTC,GTG	V493V	NP_060764.3

Gene: SNORA12
Gene Name: small nucleolar RNA, H/ACA box 12

There are no transcripts associated with this gene.

View Full Product Details