Product Details

SNP ID
rs199973159
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.11:8911515 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ACCGACGTTCCCTGCAGCGTTCAGC[A/G]AGGCTGGCTCTAGAAGTGCTGGAGA
Phenotype
MIM: 609191 MIM: 140750
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
AKIP1 PubMed Links
Additional Information
For this assay, SNP(s) [rs1133833] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
AKIP1
Gene Name
A-kinase interacting protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001206646.1 170 Silent Mutation GCA,GCG A22A NP_001193575.1
NM_001206647.1 170 Silent Mutation GCA,GCG A22A NP_001193576.1
NM_001206648.1 170 Silent Mutation GCA,GCG A22A NP_001193577.1
NM_020642.3 170 Silent Mutation GCA,GCG A22A NP_065693.2
XM_017018011.1 170 Silent Mutation GCA,GCG A22A XP_016873500.1
XM_017018012.1 170 Silent Mutation GCA,GCG A22A XP_016873501.1
Gene
C11orf16
Gene Name
chromosome 11 open reading frame 16
There are no transcripts associated with this gene.

Gene
ST5
Gene Name
suppression of tumorigenicity 5
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_005418.3 170 Intron NP_005409.3
NM_139157.2 170 Intron NP_631896.1
NM_213618.1 170 Intron NP_998783.1
XM_005253077.1 170 Intron XP_005253134.1
XM_005253083.2 170 Intron XP_005253140.1
XM_011520309.1 170 Intron XP_011518611.1
XM_011520310.1 170 Intron XP_011518612.1
XM_011520311.2 170 Intron XP_011518613.1
XM_011520312.1 170 Intron XP_011518614.1
XM_011520313.1 170 Intron XP_011518615.1
XM_011520314.1 170 Intron XP_011518616.1
XM_011520315.1 170 Intron XP_011518617.1
XM_011520316.1 170 Intron XP_011518618.1
XM_011520317.1 170 Intron XP_011518619.1
XM_011520318.1 170 Intron XP_011518620.1
XM_011520319.2 170 Intron XP_011518621.1
XM_011520320.1 170 Intron XP_011518622.1
XM_011520321.2 170 Intron XP_011518623.1
XM_011520322.1 170 Intron XP_011518624.1
XM_011520323.2 170 Intron XP_011518625.2
XM_011520324.2 170 Intron XP_011518626.2
XM_011520325.1 170 Intron XP_011518627.1
XM_011520326.1 170 Intron XP_011518628.1
XM_011520327.1 170 Intron XP_011518629.1
XM_011520328.1 170 Intron XP_011518630.1
XM_011520329.1 170 Intron XP_011518631.1
XM_017018182.1 170 Intron XP_016873671.1
XM_017018183.1 170 Intron XP_016873672.1
XM_017018184.1 170 Intron XP_016873673.1
XM_017018185.1 170 Intron XP_016873674.1
XM_017018186.1 170 Intron XP_016873675.1
XM_017018187.1 170 Intron XP_016873676.1

View Full Product Details