Product Details
- SNP ID
-
rs200184532
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:64895363 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGCTGCTGGCCCCTGCGCAGCCTC[C/T]GCGCAGAGCGCTTATCCTGCAGGGA
- Phenotype
-
MIM: 616225
MIM: 610939
MIM: 610941
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ATG2A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs77802938] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ATG2A
- Gene Name
- autophagy related 2A
- Gene
- MIR192
- Gene Name
- microRNA 192
There are no transcripts associated with this gene.
- Gene
- MIR194-2
- Gene Name
- microRNA 194-2
There are no transcripts associated with this gene.
- Gene
- MIR194-2HG
- Gene Name
- MIR194-2 host gene
There are no transcripts associated with this gene.
- Gene
- MIR6749
- Gene Name
- microRNA 6749
There are no transcripts associated with this gene.
- Gene
- MIR6750
- Gene Name
- microRNA 6750
There are no transcripts associated with this gene.
View Full Product Details