Product Details

SNP ID: rs200660106
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67432755 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTGCAGCTTCTACCTGGCTGAGAT[A/C]ACGCTGGCCCTGGGCCATCTCCACT
Phenotype: MIM: 613368 MIM: 609849 MIM: 601577 MIM: 608939
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CARNS1 PubMed Links

Gene Details

Gene: CARNS1
Gene Name: carnosine synthase 1

There are no transcripts associated with this gene.

Gene: CORO1B
Gene Name: coronin 1B

There are no transcripts associated with this gene.

Gene: PTPRCAP
Gene Name: protein tyrosine phosphatase, receptor type C associated protein

There are no transcripts associated with this gene.

Gene: RPS6KB2
Gene Name: ribosomal protein S6 kinase B2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003952.2	564	Silent Mutation	ATA,ATC	I178I	NP_003943.2
XM_005274164.1	564	Silent Mutation	ATA,ATC	I81I	XP_005274221.1
XM_005274165.4	564	UTR 5			XP_005274222.1
XM_006718655.3	564	UTR 5			XP_006718718.1
XM_006718656.3	564	UTR 5			XP_006718719.1
XM_006718657.1	564	UTR 5			XP_006718720.1
XM_017018108.1	564	UTR 5			XP_016873597.1

View Full Product Details