Product Details

SNP ID: rs200487186
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:118527595 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGACCTCGGAGAGGAAGCAGAAA[A/C]GGAAGAACGAGAAGAAGGTGGGCAT
Phenotype: MIM: 159555 MIM: 613934
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: KMT2A PubMed Links

Gene Details

Gene: KMT2A
Gene Name: lysine methyltransferase 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197104.1	101	Intron			NP_001184033.1
NM_005933.3	101	Intron			NP_005924.2
XM_006718839.3	101	Intron			XP_006718902.2
XM_011542829.2	101	Intron			XP_011541131.1
XM_011542830.2	101	Intron			XP_011541132.1
XM_011542831.2	101	Intron			XP_011541133.1
XM_011542833.2	101	Intron			XP_011541135.1

Gene: LOC101929089
Gene Name: uncharacterized LOC101929089

There are no transcripts associated with this gene.

Gene: TMEM25
Gene Name: transmembrane protein 25

There are no transcripts associated with this gene.

Gene: TTC36
Gene Name: tetratricopeptide repeat domain 36

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080441.1	101	Missense Mutation	AAG,ACG	K34T	NP_001073910.1

View Full Product Details