Product Details

SNP ID: rs199648318
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:47178406 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCATCAGCTTCCTGGCCAGCGTA[A/G]TCATAGAGTGCCCTCACCCGAACCC
Phenotype: MIM: 606908 MIM: 606513
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARFGAP2 PubMed Links

Gene Details

Gene: ARFGAP2
Gene Name: ADP ribosylation factor GTPase activating protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242832.1	1333	Intron			NP_001229761.1
NM_032389.4	1333	Intron			NP_115765.2
XM_005253166.1	1333	Intron			XP_005253223.1
XM_005253167.1	1333	Intron			XP_005253224.1
XM_005253168.2	1333	Intron			XP_005253225.1
XM_006718346.1	1333	Intron			XP_006718409.1
XM_011520405.1	1333	Intron			XP_011518707.1
XM_017018413.1	1333	Intron			XP_016873902.1
XM_017018414.1	1333	Intron			XP_016873903.1
XM_017018415.1	1333	Intron			XP_016873904.1

Gene: MIR6745
Gene Name: microRNA 6745

There are no transcripts associated with this gene.

Gene: PACSIN3
Gene Name: protein kinase C and casein kinase substrate in neurons 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184974.1	1333	Silent Mutation	GAC,GAT	D373D	NP_001171903.1
NM_001184975.1	1333	Silent Mutation	GAC,GAT	D373D	NP_001171904.1
NM_016223.4	1333	Silent Mutation	GAC,GAT	D373D	NP_057307.2

View Full Product Details