Product Details

SNP ID: rs199792888
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:66284726 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCAGGTAGAGCTGGAGACGCTGCC[A/G]GGGGACGGGGCCCCCCATGCTGTCG
Phenotype: MIM: 611288 MIM: 612565 MIM: 611484
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNIH2 PubMed Links

Gene Details

Gene: CNIH2
Gene Name: cornichon family AMPA receptor auxiliary protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182553.2	1040	Intron			NP_872359.1

Gene: RAB1B
Gene Name: RAB1B, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: TMEM151A
Gene Name: transmembrane protein 151A

There are no transcripts associated with this gene.

Gene: YIF1A
Gene Name: Yip1 interacting factor homolog A, membrane trafficking protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300861.1	1040	Missense Mutation	CGG,TGG	R213W	NP_001287790.1
NM_020470.2	1040	Missense Mutation	CGG,TGG	R265W	NP_065203.2
XM_005273720.3	1040	Silent Mutation	CCC,CCT	P294P	XP_005273777.1
XM_017017139.1	1040	Silent Mutation	CCC,CCT	P306P	XP_016872628.1
XM_017017140.1	1040	Missense Mutation	CGG,TGG	R277W	XP_016872629.1
XM_017017141.1	1040	Intron			XP_016872630.1

View Full Product Details