Product Details

SNP ID: rs201337706
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:47590214 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAACTCGGTGTCGAAGGCGAGTGG[C/T]TGGTGCCGCGGCCCGGGGCCAGCGT
Phenotype: MIM: 614911 MIM: 603846
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1QTNF4 PubMed Links

Gene Details

Gene: C1QTNF4
Gene Name: C1q and tumor necrosis factor related protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031909.2	864	Silent Mutation	CAA,CAG	Q199Q	NP_114115.2
XM_017017165.1	864	Silent Mutation	CAA,CAG	Q199Q	XP_016872654.1
XM_017017166.1	864	Silent Mutation	CAA,CAG	Q199Q	XP_016872655.1

Gene: FAM180B
Gene Name: family with sequence similarity 180 member B

There are no transcripts associated with this gene.

Gene: NDUFS3
Gene Name: NADH:ubiquinone oxidoreductase core subunit S3

There are no transcripts associated with this gene.

View Full Product Details