Product Details

SNP ID: rs201117275
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6843500 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AATCCCGTGAGGGCAATGTCAAGGT[C/G]AGCCGGGAGCTTTCTGCTCACACAG
Phenotype: MIM: 607749 MIM: 139130 MIM: 610342 MIM: 601447
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CDCA3 PubMed Links

Gene Details

Gene: CDCA3
Gene Name: cell division cycle associated 3

There are no transcripts associated with this gene.

Gene: GNB3
Gene Name: G protein subunit beta 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297571.1	615	Silent Mutation	GTC,GTG	V135V	NP_001284500.1
NM_002075.3	615	Silent Mutation	GTC,GTG	V135V	NP_002066.1
XM_011520953.2	615	Silent Mutation	GTC,GTG	V135V	XP_011519255.1

Gene: P3H3
Gene Name: prolyl 3-hydroxylase 3

There are no transcripts associated with this gene.

Gene: USP5
Gene Name: ubiquitin specific peptidase 5

There are no transcripts associated with this gene.

View Full Product Details