Product Details
- SNP ID
-
rs200345708
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:10809519 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCAAAGGATAAAGGGAACCATCACC[C/T]CCAGGTTCAGGGTTAACTGTTTGAA
- Phenotype
-
MIM: 604793
MIM: 604794
MIM: 604795
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
TAS2R7
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs3741845] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- TAS2R7
- Gene Name
- taste 2 receptor member 7
There are no transcripts associated with this gene.
- Gene
- TAS2R8
- Gene Name
- taste 2 receptor member 8
There are no transcripts associated with this gene.
- Gene
- TAS2R9
- Gene Name
- taste 2 receptor member 9
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_023917.2 |
650 |
Missense Mutation |
|
|
NP_076406.1 |
View Full Product Details