Product Details
- SNP ID
-
rs201447608
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:52287126 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTCTGCTCCTCGCCCTCCAGCAGG[C/T]GCCTGTAGGTGGCGATCTCGATGTC
- Phenotype
-
MIM: 602153
MIM: 601928
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KRT81
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs59448276] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRT81
- Gene Name
- keratin 81
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_002281.3 |
1273 |
Missense Mutation |
|
|
NP_002272.2 |
- Gene
- KRT86
- Gene Name
- keratin 86
View Full Product Details