Product Details

SNP ID: rs200582969
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24319116 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTCACCCACTCGCAGGCGGAAGT[C/T]GTTGAATGAATGCTTGTTGATGACG
Phenotype: MIM: 600292 MIM: 604441 MIM: 601531 MIM: 605773
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADCY4 PubMed Links

Gene Details

Gene: ADCY4
Gene Name: adenylate cyclase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198568.1	3056	Missense Mutation	AAC,GAC	N980D	NP_001185497.1
NM_001198592.1	3056	Missense Mutation	AAC,GAC	N980D	NP_001185521.1
NM_139247.3	3056	Missense Mutation	AAC,GAC	N980D	NP_640340.2

Gene: CIDEB
Gene Name: cell death-inducing DFFA-like effector b

There are no transcripts associated with this gene.

Gene: LTB4R
Gene Name: leukotriene B4 receptor

There are no transcripts associated with this gene.

Gene: LTB4R2
Gene Name: leukotriene B4 receptor 2

There are no transcripts associated with this gene.

Gene: NOP9
Gene Name: NOP9 nucleolar protein

There are no transcripts associated with this gene.

View Full Product Details