Product Details

SNP ID: rs201287113
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24074060 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCACCTCCATCCCCAGATTGTGTCA[A/C]AAACCAAGGTCACTAAGCCATTATT
Phenotype: MIM: 614716 MIM: 605688 MIM: 162080
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CARMIL3 PubMed Links

Gene Details

Gene: CARMIL3
Gene Name: capping protein regulator and myosin 1 linker 3

There are no transcripts associated with this gene.

Gene: CPNE6
Gene Name: copine 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001280558.1	613	Missense Mutation	AAA,CAA	K175Q	NP_001267487.1
NM_006032.3	613	Missense Mutation	AAA,CAA	K120Q	NP_006023.1
XM_005268216.1	613	Missense Mutation	AAA,CAA	K120Q	XP_005268273.1
XM_005268217.1	613	UTR 5			XP_005268274.1

Gene: NRL
Gene Name: neural retina leucine zipper

There are no transcripts associated with this gene.

View Full Product Details