Product Details

SNP ID: rs200454893
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24240450 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTCTGTGGCAGGCAAGTCAACTG[A/G]GTTCTCCTTCAGAGCCCTTCCCCCC
Phenotype: MIM: 610781 MIM: 603171 MIM: 190195 MIM: 604319
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GMPR2 PubMed Links

Gene Details

Gene: GMPR2
Gene Name: guanosine monophosphate reductase 2

There are no transcripts associated with this gene.

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TGM1
Gene Name: transglutaminase 1

There are no transcripts associated with this gene.

Gene: TINF2
Gene Name: TERF1 interacting nuclear factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099274.1	904	Missense Mutation	CCA,TCA	P344S	NP_001092744.1
NM_012461.2	904	Missense Mutation	CCA,TCA	P344S	NP_036593.2
XM_005267529.3	904	Missense Mutation	CCA,TCA	P309S	XP_005267586.1
XM_011536642.2	904	UTR 3			XP_011534944.1
XM_017021216.1	904	Missense Mutation	CCA,TCA	P130S	XP_016876705.1
XM_017021217.1	904	Missense Mutation	CCA,TCA	P130S	XP_016876706.1

View Full Product Details