Product Details

SNP ID: rs201241267
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:55418467 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATACTCCAAAGGAGCAAGTATTTT[C/A]AAGCCATATCAGAGCAACTGGATTT
Phenotype: MIM: 611326 MIM: 608706
Polymorphism: C/A, Transversion substitution
Allele Nomenclature
Literature Links: C15orf65 PubMed Links

Gene Details

Gene: C15orf65
Gene Name: chromosome 15 open reading frame 65

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198784.1	507	Nonsense Mutation	TAA,TCA	*88S	NP_001185713.1

Gene: CCPG1
Gene Name: cell cycle progression 1

There are no transcripts associated with this gene.

Gene: DYX1C1
Gene Name: dyslexia susceptibility 1 candidate 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033559.2	507	Intron			NP_001028731.1
NM_001033560.1	507	Intron			NP_001028732.1
NM_130810.3	507	Intron			NP_570722.2

Gene: DYX1C1-CCPG1
Gene Name: DYX1C1-CCPG1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details