Product Details

SNP ID

rs201656241

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.15:58887061 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GAAGCGCTGCTACGATTCCCAGGGG[C/G]AGCGCCTCTCACACTGTGCCCTGAT

Phenotype

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

SLTM PubMed Links

Additional Information

For this assay, SNP(s) [rs2124203] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SLTM

Gene Name

SAFB like transcription modulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013843.2	2656	Missense Mutation	CCC,GCC	P899A	NP_001013865.1
NM_024755.3	2656	Missense Mutation	CCC,GCC	P917A	NP_079031.2
XM_006720686.3	2656	Missense Mutation	CCC,GCC	P970A	XP_006720749.3
XM_006720690.1	2656	Missense Mutation	CCC,GCC	P486A	XP_006720753.1
XM_011522022.1	2656	Missense Mutation	CCC,GCC	P1059A	XP_011520324.1
XM_011522023.1	2656	Missense Mutation	CCC,GCC	P1041A	XP_011520325.1
XM_011522024.1	2656	Missense Mutation	CCC,GCC	P1009A	XP_011520326.1
XM_011522025.1	2656	Missense Mutation	CCC,GCC	P993A	XP_011520327.1
XM_011522026.2	2656	Missense Mutation	CCC,GCC	P986A	XP_011520328.2
XM_011522027.1	2656	Missense Mutation	CCC,GCC	P977A	XP_011520329.1
XM_011522028.1	2656	Missense Mutation	CCC,GCC	P959A	XP_011520330.1
XM_011522029.2	2656	Missense Mutation	CCC,GCC	P871A	XP_011520331.1
XM_011522030.2	2656	Intron			XP_011520332.1
XM_011522031.2	2656	Missense Mutation	CCC,GCC	P689A	XP_011520333.1
XM_017022576.1	2656	Missense Mutation	CCC,GCC	P849A	XP_016878065.1
XM_017022577.1	2656	Missense Mutation	CCC,GCC	P968A	XP_016878066.1
XM_017022578.1	2656	Missense Mutation	CCC,GCC	P952A	XP_016878067.1
XM_017022579.1	2656	Missense Mutation	CCC,GCC	P864A	XP_016878068.1
XM_017022580.1	2656	Missense Mutation	CCC,GCC	P486A	XP_016878069.1

View Full Product Details