Product Details
- SNP ID
-
rs200496423
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:67176948 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTATTATCCAGCACCCCATGGGGCC[A/G]CAGGTGGTCCACATCCTCATAGGAC
- Phenotype
-
MIM: 614117
MIM: 602438
MIM: 605235
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
EXOC3L1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs61733789] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- EXOC3L1
- Gene Name
- exocyst complex component 3 like 1
There are no transcripts associated with this gene.
- Gene
- HSF4
- Gene Name
- heat shock transcription factor 4
There are no transcripts associated with this gene.
- Gene
- KIAA0895L
- Gene Name
- KIAA0895 like
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001040715.1 |
2054 |
Missense Mutation |
CGG,TGG |
R427W |
NP_001035805.1 |
- Gene
- NOL3
- Gene Name
- nucleolar protein 3
There are no transcripts associated with this gene.
View Full Product Details