Product Details

SNP ID: rs201280263
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29968182 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGGGCTGGAAATGCCACCCTGAG[C/T]CCTAGAATGGGTGAGGAATGTGTTA
Phenotype: MIM: 613199
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC107987231 PubMed Links

Gene Details

Gene: LOC107987231
Gene Name: uncharacterized LOC107987231

There are no transcripts associated with this gene.

Gene: TAOK2
Gene Name: TAO kinase 2

There are no transcripts associated with this gene.

Gene: TMEM219
Gene Name: transmembrane protein 219

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083613.1	652	Silent Mutation	AGC,AGT	S171S	NP_001077082.1
NM_194280.3	652	Silent Mutation	AGC,AGT	S171S	NP_919256.1
XM_005255123.1	652	Silent Mutation	AGC,AGT	S171S	XP_005255180.1

View Full Product Details