Product Details

SNP ID
rs200008990
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.16:84178967 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CAGAAGCCCATTCGAGGCTTCTTCC[A/G]GAGGGGCTGAGAGCTAGAGAGGACG
Phenotype
MIM: 613190 MIM: 604905
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
DNAAF1 PubMed Links
Additional Information
For this assay, SNP(s) [rs1804500] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
DNAAF1
Gene Name
dynein axonemal assembly factor 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001318756.1 2841 Intron NP_001305685.1
NM_178452.5 2841 Intron NP_848547.4
XM_006721129.2 2841 Intron XP_006721192.1
XM_011522853.2 2841 Intron XP_011521155.1
XM_011522854.2 2841 Intron XP_011521156.1
XM_011522855.2 2841 Intron XP_011521157.1
XM_011522857.2 2841 Intron XP_011521159.1
XM_011522858.2 2841 Intron XP_011521160.1
XM_017022918.1 2841 Intron XP_016878407.1
XM_017022919.1 2841 Intron XP_016878408.1
XM_017022920.1 2841 Intron XP_016878409.1
XM_017022921.1 2841 Intron XP_016878410.1
XM_017022922.1 2841 Intron XP_016878411.1
Gene
TAF1C
Gene Name
TATA-box binding protein associated factor, RNA polymerase I subunit C
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001243156.1 2841 Missense Mutation CGG,TGG R836W NP_001230085.1
NM_001243157.1 2841 Missense Mutation CGG,TGG R530W NP_001230086.1
NM_001243158.1 2841 Missense Mutation CGG,TGG R530W NP_001230087.1
NM_001243159.1 2841 Missense Mutation CGG,TGG R453W NP_001230088.1
NM_001243160.1 2841 Missense Mutation CGG,TGG R385W NP_001230089.1
NM_005679.3 2841 Missense Mutation CGG,TGG R862W NP_005670.3
NM_139353.2 2841 Missense Mutation CGG,TGG R768W NP_647610.2
XM_005256226.3 2841 Missense Mutation CGG,TGG R862W XP_005256283.1
XM_005256227.3 2841 Missense Mutation CGG,TGG R795W XP_005256284.1
XM_006721325.3 2841 Missense Mutation CGG,TGG R863W XP_006721388.1
XM_006721326.3 2841 Missense Mutation CGG,TGG R837W XP_006721389.1
XM_017023845.1 2841 Missense Mutation CGG,TGG R836W XP_016879334.1
XM_017023846.1 2841 Missense Mutation CGG,TGG R795W XP_016879335.1
XM_017023847.1 2841 Missense Mutation CGG,TGG R769W XP_016879336.1
XM_017023848.1 2841 Missense Mutation CGG,TGG R530W XP_016879337.1

View Full Product Details