Product Details

SNP ID: rs200929543
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2213824 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACACGCAGTCACTTTCCTGATTATT[C/T]TTCACATCCCCTAGAGTGGAGACTC
Phenotype: MIM: 603022 MIM: 612190 MIM: 172280
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BRICD5 PubMed Links

Gene Details

Gene: BRICD5
Gene Name: BRICHOS domain containing 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182563.3	914	Intron			NP_872369.2
XM_005255263.4	914	Intron			XP_005255320.1

Gene: E4F1
Gene Name: E4F transcription factor 1

There are no transcripts associated with this gene.

Gene: MLST8
Gene Name: MTOR associated protein, LST8 homolog

There are no transcripts associated with this gene.

Gene: PGP
Gene Name: phosphoglycolate phosphatase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042371.2	914	Silent Mutation	AAA,AAG	K290K	NP_001035830.1

View Full Product Details