Product Details

SNP ID: rs200869087
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30092741 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGCCGTTGTCTTTGATCATGTGG[G/T]TGAGTTCAATGATGTACTTCCCCTC
Phenotype: MIM: 602035 MIM: 602427 MIM: 609724
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC101928595 PubMed Links

Gene Details

Gene: LOC101928595
Gene Name: uncharacterized LOC101928595

There are no transcripts associated with this gene.

Gene: PPP4C
Gene Name: protein phosphatase 4 catalytic subunit

There are no transcripts associated with this gene.

Gene: TBX6
Gene Name: T-box 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004608.3	515	Intron			NP_004599.2
XM_005255523.2	515	Intron			XP_005255580.1
XM_011545926.2	515	Intron			XP_011544228.1
XM_017023614.1	515	Intron			XP_016879103.1

Gene: YPEL3
Gene Name: yippee like 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145524.1	515	Missense Mutation	AAC,ACC	N110T	NP_001138996.1
NM_031477.4	515	Missense Mutation	AAC,ACC	N148T	NP_113665.3

View Full Product Details