Product Details

SNP ID: rs199856420
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:563879 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCCTGCTATCCCCCGCCTGCCCC[A/C]GGGGAGTTCCCTGAGGCCCACAGCC
Phenotype: MIM: 603267 MIM: 605754
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CAPN15 PubMed Links

Gene Details

Gene: CAPN15
Gene Name: calpain 15

There are no transcripts associated with this gene.

Gene: LOC107987233
Gene Name: uncharacterized LOC107987233

There are no transcripts associated with this gene.

Gene: NHLRC4
Gene Name: NHL repeat containing 4

There are no transcripts associated with this gene.

Gene: PIGQ
Gene Name: phosphatidylinositol glycan anchor biosynthesis class Q

There are no transcripts associated with this gene.

Gene: PRR35
Gene Name: proline rich 35

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145270.2	864	Silent Mutation	CCA,CCC	P195P	NP_660313.1
XM_017022959.1	864	Silent Mutation	CCA,CCC	P195P	XP_016878448.1
XM_017022960.1	864	Silent Mutation	CCA,CCC	P195P	XP_016878449.1
XM_017022961.1	864	Intron			XP_016878450.1

View Full Product Details