Product Details

SNP ID: rs200817061
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:31473724 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCAGGAGCCTCGGGGGACAAGGAC[C/G]ACCTGTACAGGTGAGGGGCCTGGAA
Phenotype: MIM: 615549 MIM: 182381 MIM: 602353
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ARMC5 PubMed Links

Gene Details

Gene: ARMC5
Gene Name: armadillo repeat containing 5

There are no transcripts associated with this gene.

Gene: SLC5A2
Gene Name: solute carrier family 5 member 2

There are no transcripts associated with this gene.

Gene: TGFB1I1
Gene Name: transforming growth factor beta 1 induced transcript 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042454.2	175	Missense Mutation	CAC,GAC	H58D	NP_001035919.1
NM_001164719.1	175	Missense Mutation	CAC,GAC	H41D	NP_001158191.1
NM_015927.4	175	Missense Mutation	CAC,GAC	H41D	NP_057011.2

View Full Product Details