Product Details

SNP ID: rs200094220
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30899422 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCCCCTTTCCCACCAGAAGACCC[A/C]CAGACTGATTCCTCAGTCTCACTTC
Phenotype: MIM: 605847 MIM: 600435
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: BCL7C PubMed Links

Gene Details

Gene: BCL7C
Gene Name: BCL tumor suppressor 7C

There are no transcripts associated with this gene.

Gene: CTF1
Gene Name: cardiotrophin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142544.1	179	Silent Mutation	CCA,CCC	P10P	NP_001136016.1
NM_001330.3	179	Silent Mutation	CCA,CCC	P11P	NP_001321.1
XM_011545759.2	179	Silent Mutation	CCA,CCC	P33P	XP_011544061.1
XM_011545760.2	179	Silent Mutation	CCA,CCC	P19P	XP_011544062.1

Gene: MIR762
Gene Name: microRNA 762

There are no transcripts associated with this gene.

Gene: MIR762HG
Gene Name: MIR762 host gene

There are no transcripts associated with this gene.

View Full Product Details