Product Details

SNP ID: rs201736719
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67662484 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGTCATTGAGAACCGCCAGCCTC[C/G]CAGTTCCAATGGGCTGTCTCAGGGG
Phenotype: MIM: 609377 MIM: 610859 MIM: 607484
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ACD PubMed Links

Gene Details

Gene: ACD
Gene Name: adrenocortical dysplasia homolog

There are no transcripts associated with this gene.

Gene: C16orf86
Gene Name: chromosome 16 open reading frame 86

There are no transcripts associated with this gene.

Gene: CARMIL2
Gene Name: capping protein regulator and myosin 1 linker 2

There are no transcripts associated with this gene.

Gene: ENKD1
Gene Name: enkurin domain containing 1

There are no transcripts associated with this gene.

Gene: PARD6A
Gene Name: par-6 family cell polarity regulator alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037281.1	937	Missense Mutation	CCC,CGC	P292R	NP_001032358.1
NM_016948.2	937	Missense Mutation	CCC,CGC	P293R	NP_058644.1
XM_005255977.3	937	Missense Mutation	CCC,CGC	P304R	XP_005256034.1
XM_011523095.2	937	Missense Mutation	CCC,CGC	P303R	XP_011521397.1
XM_011523096.2	937	Missense Mutation	CCC,CGC	P300R	XP_011521398.1
XM_017023261.1	937	Missense Mutation	CCC,CGC	P288R	XP_016878750.1

View Full Product Details