Product Details

SNP ID: rs199513433
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42114583 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCTTGCGGATCTGGGCCTGTTTGC[A/G]CTCAATCAGCTTCTTGATGATCTGA
Phenotype: MIM: 608588 MIM: 608344 MIM: 602301
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DHX58 PubMed Links

Gene Details

Gene: DHX58
Gene Name: DEXH-box helicase 58

There are no transcripts associated with this gene.

Gene: HSPB9
Gene Name: heat shock protein family B (small) member 9

There are no transcripts associated with this gene.

Gene: KAT2A
Gene Name: lysine acetyltransferase 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021078.2	2133	Missense Mutation	CGC,TGC	R681C	NP_066564.2
XM_006721817.3	2133	Missense Mutation	CGC,TGC	R682C	XP_006721880.1
XM_006721818.3	2133	Missense Mutation	CGC,TGC	R321C	XP_006721881.1
XM_017024448.1	2133	Missense Mutation	CGC,TGC	R320C	XP_016879937.1

View Full Product Details