Product Details

SNP ID: rs200504646
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:47847378 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCTCCACTGCGCCGCCGGCCTTG[C/G]CCTCTCCCGAGGCCGCCCCAGCCGC
Phenotype: MIM: 614966 MIM: 608613
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LRRC46 PubMed Links

Gene Details

Gene: LRRC46
Gene Name: leucine rich repeat containing 46

There are no transcripts associated with this gene.

Gene: SCRN2
Gene Name: secernin 2

There are no transcripts associated with this gene.

Gene: SP6
Gene Name: Sp6 transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258248.1	1293	Missense Mutation	GCC,GGC	A351G	NP_001245177.1
NM_199262.2	1293	Missense Mutation	GCC,GGC	A351G	NP_954871.1
XM_006722115.3	1293	Missense Mutation	GCC,GGC	A351G	XP_006722178.1

View Full Product Details