Product Details

SNP ID: rs199558467
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7026470 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCCTTCCCAGGAAGTGAATTTTT[A/C]AGCTGCCAGAACTGTGAGGCTGTGG
Phenotype: MIM: 608992 MIM: 610718 MIM: 615672
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: BCL6B PubMed Links

Gene Details

Gene: BCL6B
Gene Name: B-cell CLL/lymphoma 6B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181844.3	968	Missense Mutation	TTA,TTC	L302F	NP_862827.1

Gene: C17orf49
Gene Name: chromosome 17 open reading frame 49

There are no transcripts associated with this gene.

Gene: MIR195
Gene Name: microRNA 195

There are no transcripts associated with this gene.

Gene: MIR497
Gene Name: microRNA 497

There are no transcripts associated with this gene.

Gene: MIR497HG
Gene Name: mir-497-195 cluster host gene

There are no transcripts associated with this gene.

Gene: RNASEK-C17orf49
Gene Name: RNASEK-C17orf49 readthrough

There are no transcripts associated with this gene.

Gene: SLC16A13
Gene Name: solute carrier family 16 member 13

There are no transcripts associated with this gene.

View Full Product Details