Product Details

SNP ID: rs200993285
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.17:68042182 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCTTCTTGGGCAGAACTGATTGT[A/G]GTCCCATTCAGTTTGAATCTGCTTG
Phenotype: MIM: 600685
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: KPNA2 PubMed Links
Additional Information: For this assay, SNP(s) [rs62084696] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320611.1	1020	Missense Mutation	AGT,GGT	S134G	NP_001307540.1
NM_002266.3	1020	Intron			NP_002257.1