Product Details

SNP ID: rs201200598
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81672090 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTCCTCCAGACACGGTGAAGTTT[C/G]GTGAGGTTGTCCTGCAGCCCCCAGA
Phenotype: MIM: 614271 MIM: 180073
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ARL16 PubMed Links

Gene Details

Gene: ARL16
Gene Name: ADP ribosylation factor like GTPase 16

There are no transcripts associated with this gene.

Gene: CCDC137
Gene Name: coiled-coil domain containing 137

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199287.2	533	Missense Mutation	CGT,GGT	R199G	NP_954981.1
XM_011524738.2	533	Missense Mutation	CGT,GGT	R71G	XP_011523040.1
XM_017024573.1	533	Intron			XP_016880062.1

Gene: OXLD1
Gene Name: oxidoreductase like domain containing 1

There are no transcripts associated with this gene.

Gene: PDE6G
Gene Name: phosphodiesterase 6G

There are no transcripts associated with this gene.

View Full Product Details