Product Details

SNP ID: rs201646494
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81686345 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGCTGTGAATTCCATCAAGAAGAA[A/G]GTCAACGACAAGAACCCACACGTCG
Phenotype: MIM: 604375
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARL16 PubMed Links

Gene Details

Gene: ARL16
Gene Name: ADP ribosylation factor like GTPase 16

There are no transcripts associated with this gene.

Gene: HGS
Gene Name: hepatocyte growth factor-regulated tyrosine kinase substrate

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004712.4	240	Silent Mutation	AAA,AAG	K52K	NP_004703.1
XM_011525463.2	240	Silent Mutation	AAA,AAG	K52K	XP_011523765.1
XM_017025297.1	240	Silent Mutation	AAA,AAG	K43K	XP_016880786.1
XM_017025298.1	240	UTR 5			XP_016880787.1

Gene: MIR6786
Gene Name: microRNA 6786

There are no transcripts associated with this gene.

View Full Product Details