Product Details

SNP ID

rs200823933

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:75627692 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGGCGGGCAAAGCCTTTAAACAACT[C/T]CTGGAAGGGAGAGGGAGAAGAGAAG

Phenotype

MIM: 603781

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MYO15B PubMed Links

Additional Information

For this assay, SNP(s) [rs376539887] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MYO15B

Gene Name

myosin XVB

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001309242.1	1910	Intron			NP_001296171.1
XM_017025120.1	1910	Intron			XP_016880609.1
XM_017025121.1	1910	Intron			XP_016880610.1
XM_017025122.1	1910	Intron			XP_016880611.1
XM_017025123.1	1910	Intron			XP_016880612.1
XM_017025124.1	1910	Intron			XP_016880613.1
XM_017025125.1	1910	Intron			XP_016880614.1
XM_017025126.1	1910	Intron			XP_016880615.1
XM_017025127.1	1910	Intron			XP_016880616.1
XM_017025128.1	1910	Intron			XP_016880617.1
XM_017025129.1	1910	Intron			XP_016880618.1
XM_017025130.1	1910	Intron			XP_016880619.1
XM_017025131.1	1910	Intron			XP_016880620.1
XM_017025132.1	1910	Intron			XP_016880621.1
XM_017025133.1	1910	Intron			XP_016880622.1
XM_017025134.1	1910	Intron			XP_016880623.1
XM_017025135.1	1910	Intron			XP_016880624.1
XM_017025136.1	1910	Intron			XP_016880625.1
XM_017025137.1	1910	Intron			XP_016880626.1
XM_017025138.1	1910	Intron			XP_016880627.1
XM_017025139.1	1910	Intron			XP_016880628.1
XM_017025140.1	1910	Intron			XP_016880629.1
XM_017025141.1	1910	Intron			XP_016880630.1
XM_017025142.1	1910	Intron			XP_016880631.1
XM_017025143.1	1910	Intron			XP_016880632.1
XM_017025144.1	1910	Intron			XP_016880633.1

Gene

RECQL5

Gene Name

RecQ like helicase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003715.3	1910	Intron			NP_001003715.1
NM_001003716.3	1910	Intron			NP_001003716.1
NM_004259.6	1910	Missense Mutation			NP_004250.4
XM_005257818.3	1910	Nonsense Mutation			XP_005257875.1
XM_005257822.3	1910	Nonsense Mutation			XP_005257879.1
XM_005257823.3	1910	Intron			XP_005257880.1
XM_006722186.2	1910	Nonsense Mutation			XP_006722249.1
XM_011525482.2	1910	Nonsense Mutation			XP_011523784.1
XM_011525484.1	1910	Nonsense Mutation			XP_011523786.1
XM_011525485.2	1910	Nonsense Mutation			XP_011523787.1
XM_011525486.2	1910	Nonsense Mutation			XP_011523788.1
XM_017025343.1	1910	Nonsense Mutation			XP_016880832.1
XM_017025344.1	1910	Intron			XP_016880833.1

Gene

SMIM5

Gene Name

small integral membrane protein 5

There are no transcripts associated with this gene.

View Full Product Details