Product Details

SNP ID: rs200842828
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:75261938 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGTGAAGGTTGCCCGAGGATGGT[C/T]GGGCCTGGCGTTGGGCGTGCGGCGG
Phenotype: MIM: 606006 MIM: 612072 MIM: 611974
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GGA3 PubMed Links

Gene Details

Gene: GGA3
Gene Name: golgi associated, gamma adaptin ear containing, ARF binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172703.2	271	Intron			NP_001166174.1
NM_001172704.2	271	Intron			NP_001166175.1
NM_001291641.1	271	Intron			NP_001278570.1
NM_001291642.1	271	Intron			NP_001278571.1
NM_014001.4	271	Intron			NP_054720.1
NM_138619.3	271	Intron			NP_619525.1
XM_011524563.2	271	Intron			XP_011522865.1
XM_017024385.1	271	Intron			XP_016879874.1
XM_017024386.1	271	Intron			XP_016879875.1
XM_017024387.1	271	Intron			XP_016879876.1
XM_017024388.1	271	Intron			XP_016879877.1
XM_017024389.1	271	Intron			XP_016879878.1
XM_017024390.1	271	Intron			XP_016879879.1
XM_017024391.1	271	Intron			XP_016879880.1
XM_017024392.1	271	Intron			XP_016879881.1

Gene: LOC100287042
Gene Name: uncharacterized LOC100287042

There are no transcripts associated with this gene.

Gene: MIF4GD
Gene Name: MIF4G domain containing

There are no transcripts associated with this gene.

Gene: MRPS7
Gene Name: mitochondrial ribosomal protein S7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015971.3	271	Missense Mutation	TCG,TTG	S13L	NP_057055.2

View Full Product Details