Product Details

SNP ID: rs200915782
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:6652214 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGACGTCTCTGCACTGCGCGGAG[A/G]GCCCGACCCCGCGGGCCAAGCCGGC
Phenotype: MIM: 616967
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALOX15P1 PubMed Links

Gene Details

Gene: ALOX15P1
Gene Name: arachidonate 15-lipoxygenase pseudogene 1

There are no transcripts associated with this gene.

Gene: C17orf100
Gene Name: chromosome 17 open reading frame 100

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001105520.1	476	Missense Mutation	AGC,GGC	S101G	NP_001098990.1

Gene: MED31
Gene Name: mediator complex subunit 31

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016060.2	476	Intron			NP_057144.1
XM_017024710.1	476	Intron			XP_016880199.1

Gene: MIR4520-1
Gene Name: microRNA 4520-1

There are no transcripts associated with this gene.

Gene: MIR4520-2
Gene Name: microRNA 4520-2

There are no transcripts associated with this gene.

Gene: TXNDC17
Gene Name: thioredoxin domain containing 17

There are no transcripts associated with this gene.

View Full Product Details