Product Details
- SNP ID
-
rs201740659
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:42774679 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTGTGGAGTCGATCCAGATTGTAT[C/T]AGAGGAACTGAGGAAGAAAGGTGGG
- Phenotype
-
MIM: 610907
MIM: 601844
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
VPS25
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2305218] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- VPS25
- Gene Name
- vacuolar protein sorting 25 homolog
- Gene
- WNK4
- Gene Name
- WNK lysine deficient protein kinase 4
There are no transcripts associated with this gene.
View Full Product Details