Product Details

SNP ID

rs202024343

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.18:48029412 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGCGCGAAGGCCAGGAGGCCCCCCG[C/G]GTTCCTCTCAGCCTCCAGCTGCGCG

Phenotype

MIM: 616591

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

ZBTB7C PubMed Links

Additional Information

For this assay, SNP(s) [rs7231151] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZBTB7C

Gene Name

zinc finger and BTB domain containing 7C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039360.2	2421	Missense Mutation	CCG,GCG	P570A	NP_001034449.1
NM_001318841.1	2421	Missense Mutation	CCG,GCG	P570A	NP_001305770.1
XM_005258229.4	2421	Missense Mutation	CCG,GCG	P570A	XP_005258286.1
XM_011525861.2	2421	Missense Mutation	CCG,GCG	P619A	XP_011524163.1
XM_011525863.2	2421	Missense Mutation	CCG,GCG	P579A	XP_011524165.1
XM_011525864.2	2421	Missense Mutation	CCG,GCG	P579A	XP_011524166.1
XM_011525865.2	2421	Missense Mutation	CCG,GCG	P579A	XP_011524167.1
XM_011525866.2	2421	Missense Mutation	CCG,GCG	P579A	XP_011524168.1
XM_011525867.2	2421	Missense Mutation	CCG,GCG	P579A	XP_011524169.1
XM_011525869.2	2421	Missense Mutation	CCG,GCG	P578A	XP_011524171.1
XM_011525870.2	2421	Missense Mutation	CCG,GCG	P570A	XP_011524172.1
XM_011525871.2	2421	Missense Mutation	CCG,GCG	P570A	XP_011524173.1
XM_017025605.1	2421	Missense Mutation	CCG,GCG	P619A	XP_016881094.1
XM_017025606.1	2421	Missense Mutation	CCG,GCG	P579A	XP_016881095.1
XM_017025607.1	2421	Missense Mutation	CCG,GCG	P579A	XP_016881096.1
XM_017025608.1	2421	Missense Mutation	CCG,GCG	P578A	XP_016881097.1
XM_017025609.1	2421	Missense Mutation	CCG,GCG	P570A	XP_016881098.1

View Full Product Details