Product Details

SNP ID: rs200022475
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35739626 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGTTGTGACGCCAGACTGGACAGT[A/T]CTGGAAGAAAGGGGAAGGGTAAAGG
Phenotype: MIM: 614143 MIM: 606834 MIM: 607632 MIM: 601080
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: IGFLR1 PubMed Links

Gene Details

Gene: IGFLR1
Gene Name: IGF like family receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024660.2	820	Missense Mutation	GAA,GTA	E241V	NP_078936.1

Gene: KMT2B
Gene Name: lysine methyltransferase 2B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014727.2	820	Intron			NP_055542.1
XM_011527561.2	820	Intron			XP_011525863.2
XM_011527562.2	820	Intron			XP_011525864.1
XM_017027544.1	820	Intron			XP_016883033.1
XM_017027545.1	820	Intron			XP_016883034.1
XM_017027546.1	820	Intron			XP_016883035.1

Gene: LIN37
Gene Name: lin-37 DREAM MuvB core complex component

There are no transcripts associated with this gene.

Gene: PSENEN
Gene Name: presenilin enhancer gamma-secretase subunit

There are no transcripts associated with this gene.

Gene: U2AF1L4
Gene Name: U2 small nuclear RNA auxiliary factor 1 like 4

There are no transcripts associated with this gene.

View Full Product Details