Product Details

SNP ID: rs199990847
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48721899 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTGCAGGGGGAGGGTCCCACGCGG[C/T]TGGCGGCCCGCGGCCAGGGCCCAGC
Phenotype: MIM: 610349 MIM: 609623
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAMSTR PubMed Links

Gene Details

Gene: MAMSTR
Gene Name: MEF2 activating motif and SAP domain containing transcriptional regulator

There are no transcripts associated with this gene.

Gene: RASIP1
Gene Name: Ras interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017805.2	2670	Missense Mutation	ACC,GCC	T883A	NP_060275.2
XM_011527053.2	2670	Missense Mutation	ACC,GCC	T984A	XP_011525355.2
XM_011527054.2	2670	Missense Mutation	ACC,GCC	T984A	XP_011525356.2
XM_011527055.2	2670	Missense Mutation	ACC,GCC	T886A	XP_011525357.2
XM_017026914.1	2670	Missense Mutation	ACC,GCC	T984A	XP_016882403.1
XM_017026915.1	2670	Missense Mutation	ACC,GCC	T886A	XP_016882404.1

View Full Product Details