Product Details
- SNP ID
-
rs199821933
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:55386747 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCGGCCCCTTTCCCGGGTCTGGGAG[C/T]TGTGATTTTTTACTGTCAGGCAGGA
- Phenotype
-
MIM: 603638
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR6805
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs546268325] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR6805
- Gene Name
- microRNA 6805
There are no transcripts associated with this gene.
- Gene
- RPL28
- Gene Name
- ribosomal protein L28
- Gene
- TMEM190
- Gene Name
- transmembrane protein 190
There are no transcripts associated with this gene.
- Gene
- TMEM238
- Gene Name
- transmembrane protein 238
There are no transcripts associated with this gene.
View Full Product Details