Product Details

SNP ID: rs199901033
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:852352 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCATGACCCTCGGCCGCCGACTCGC[A/G]TGTCTTTTCCTCGCCTGTGTCCTGC
Phenotype: MIM: 134350 MIM: 130130 MIM: 177020
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CFD PubMed Links

Gene Details

Gene: CFD
Gene Name: complement factor D

There are no transcripts associated with this gene.

Gene: ELANE
Gene Name: elastase, neutrophil expressed

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001972.3	160	Silent Mutation	GCA,GCG	A8A	NP_001963.1
XM_011527775.1	160	Silent Mutation	GCA,GCG	A8A	XP_011526077.1
XM_011527776.1	160	Silent Mutation	GCA,GCG	A8A	XP_011526078.1

Gene: PRTN3
Gene Name: proteinase 3

There are no transcripts associated with this gene.

View Full Product Details