Product Details

SNP ID: rs199586447
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:43535528 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTCTCATTTCCCTCCAAGCTGGC[C/T]GCCCATCGCCTATGTCACGACCCCC
Phenotype: MIM: 608451 MIM: 194360
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ETHE1 PubMed Links

Gene Details

Gene: ETHE1
Gene Name: ETHE1, persulfide dioxygenase

There are no transcripts associated with this gene.

Gene: XRCC1
Gene Name: X-ray repair cross complementing 1

There are no transcripts associated with this gene.

Gene: ZNF575
Gene Name: zinc finger protein 575

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_174945.2	849	Silent Mutation	GCC,GCT	A193A	NP_777605.1
XM_005258783.3	849	Silent Mutation	GCC,GCT	A193A	XP_005258840.1
XM_011526793.2	849	Silent Mutation	GCC,GCT	A193A	XP_011525095.1

View Full Product Details