Product Details

SNP ID: rs199937339
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35742614 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGAACAGATTACATTATGGAGCCC[A/G]GGAGCCTGGGAAGGATGGGGCAGGA
Phenotype: MIM: 614143 MIM: 606834 MIM: 607632 MIM: 601080
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IGFLR1 PubMed Links

Gene Details

Gene: IGFLR1
Gene Name: IGF like family receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024660.2	702	Intron			NP_078936.1

Gene: KMT2B
Gene Name: lysine methyltransferase 2B

There are no transcripts associated with this gene.

Gene: LIN37
Gene Name: lin-37 DREAM MuvB core complex component

There are no transcripts associated with this gene.

Gene: PSENEN
Gene Name: presenilin enhancer gamma-secretase subunit

There are no transcripts associated with this gene.

Gene: U2AF1L4
Gene Name: U2 small nuclear RNA auxiliary factor 1 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040425.2	702	UTR 3			NP_001035515.1
NM_144987.3	702	Missense Mutation			NP_659424.2

View Full Product Details