Product Details

SNP ID: rs200395884
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48616086 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGACCACGTATCACTCACCGGAGAG[A/C]AGGACAGTGCCACAGCCCTTAGGGG
Phenotype: MIM: 604179 MIM: 609932 MIM: 607092
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM83E PubMed Links

Gene Details

Gene: FAM83E
Gene Name: family with sequence similarity 83 member E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017708.3	689	Intron			NP_060178.2

Gene: RPL18
Gene Name: ribosomal protein L18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000979.3	689	Silent Mutation	CTG,CTT	L138L	NP_000970.1
NM_001270490.1	689	Silent Mutation	CTG,CTT	L109L	NP_001257419.1

Gene: SPACA4
Gene Name: sperm acrosome associated 4

There are no transcripts associated with this gene.

Gene: SPHK2
Gene Name: sphingosine kinase 2

There are no transcripts associated with this gene.

View Full Product Details