Product Details

SNP ID: rs56186508
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54803892 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTCATCATGATCTTTCTTTGCAGG[A/G]TTCTTCTTGGACCAGAGTGTGTGGG
Phenotype: MIM: 604945
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KIR2DL4 PubMed Links

Gene Details

Gene: KIR2DL4
Gene Name: killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080770.1	82	Silent Mutation	GGA,GGG	G14G	NP_001074239.1
NM_001080772.1	82	Silent Mutation	GGA,GGG	G14G	NP_001074241.1
NM_002255.5	82	Silent Mutation	GGA,GGG	G14G	NP_002246.5

Gene: LOC102724300
Gene Name: uncharacterized LOC102724300

There are no transcripts associated with this gene.

View Full Product Details