Product Details

SNP ID: rs200412799
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:814594 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCTTGGTGGTGTCCGAGATGACC[A/G]AGTTGAAGTACATCTGGGGCATGGG
Phenotype: MIM: 610391 MIM: 600693
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR3187 PubMed Links

Gene Details

Gene: MIR3187
Gene Name: microRNA 3187

There are no transcripts associated with this gene.

Gene: MIR4745
Gene Name: microRNA 4745

There are no transcripts associated with this gene.

Gene: PLPPR3
Gene Name: phospholipid phosphatase related 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270366.1	1411	Missense Mutation	TCG,TTG	S224L	NP_001257295.1
NM_024888.2	1411	Missense Mutation	TCG,TTG	S252L	NP_079164.1
XM_011528317.2	1411	Missense Mutation	TCG,TTG	S252L	XP_011526619.1

Gene: PTBP1
Gene Name: polypyrimidine tract binding protein 1

There are no transcripts associated with this gene.

View Full Product Details