Product Details

SNP ID: rs201573080
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49880382 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCAGCACTGTGCGGCCACAGCTCT[A/G]CCACTCAGAGCCCACGAGAGGTAGG
Phenotype: MIM: 610221 MIM: 609742 MIM: 616659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AKT1S1 PubMed Links

Gene Details

Gene: AKT1S1
Gene Name: AKT1 substrate 1

There are no transcripts associated with this gene.

Gene: IL4I1
Gene Name: interleukin 4 induced 1

There are no transcripts associated with this gene.

Gene: MIR4750
Gene Name: microRNA 4750

There are no transcripts associated with this gene.

Gene: TBC1D17
Gene Name: TBC1 domain family member 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001168222.1	499	Missense Mutation	TAC,TGC	Y67C	NP_001161694.1
NM_024682.2	499	Missense Mutation	TAC,TGC	Y100C	NP_078958.2
XM_011527317.2	499	Missense Mutation	TAC,TGC	Y100C	XP_011525619.1

View Full Product Details