Product Details

SNP ID: rs200967897
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48630963 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTCTCCAGGAAGGCCGCCCGCAC[C/T]GATATCTGGTTCTCCTTGAGCCGCC
Phenotype: MIM: 604644 MIM: 124097 MIM: 607092
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CA11 PubMed Links

Gene Details

Gene: CA11
Gene Name: carbonic anhydrase 11

There are no transcripts associated with this gene.

Gene: DBP
Gene Name: D-box binding PAR bZIP transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001352.4	1106	Silent Mutation	TCA,TCG	S284S	NP_001343.2
XM_017026388.1	1106	Silent Mutation	TCA,TCG	S141S	XP_016881877.1

Gene: SEC1P
Gene Name: secretory blood group 1, pseudogene

There are no transcripts associated with this gene.

Gene: SPHK2
Gene Name: sphingosine kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204158.2	1106	Intron			NP_001191087.1
NM_001204159.2	1106	Intron			NP_001191088.1
NM_001204160.2	1106	Intron			NP_001191089.1
NM_001243876.1	1106	Intron			NP_001230805.1
NM_020126.4	1106	Intron			NP_064511.2
XM_006723292.1	1106	Intron			XP_006723355.1
XM_011527133.1	1106	Intron			XP_011525435.1
XM_011527134.1	1106	Intron			XP_011525436.1
XM_017027008.1	1106	Intron			XP_016882497.1
XM_017027009.1	1106	Intron			XP_016882498.1
XM_017027010.1	1106	Intron			XP_016882499.1

View Full Product Details