Product Details

SNP ID: rs201519815
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:43535565 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGTCACGACCCCCCAACCGCGCCC[A/G]GCAGCCAGGCGACTGCCTGGCACCG
Phenotype: MIM: 608451 MIM: 194360
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ETHE1 PubMed Links

Gene Details

Gene: ETHE1
Gene Name: ETHE1, persulfide dioxygenase

There are no transcripts associated with this gene.

Gene: XRCC1
Gene Name: X-ray repair cross complementing 1

There are no transcripts associated with this gene.

Gene: ZNF575
Gene Name: zinc finger protein 575

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_174945.2	886	Missense Mutation	AGC,GGC	S206G	NP_777605.1
XM_005258783.3	886	Missense Mutation	AGC,GGC	S206G	XP_005258840.1
XM_011526793.2	886	Missense Mutation	AGC,GGC	S206G	XP_011525095.1

View Full Product Details