Product Details

SNP ID: rs201520620
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:47492967 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCCCCACCTGTCCCCACCTGTTC[A/G]TAGATGTCAATGGCCTTCTGATACT
Phenotype: MIM: 615620 MIM: 603215
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KPTN PubMed Links

Gene Details

Gene: KPTN
Gene Name: kaptin, actin binding protein

There are no transcripts associated with this gene.

Gene: NAPA
Gene Name: NSF attachment protein alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003827.3	547	Silent Mutation	TAC,TAT	Y185Y	NP_003818.2
XM_011527436.1	547	Silent Mutation	TAC,TAT	Y135Y	XP_011525738.1
XM_011527437.1	547	Silent Mutation	TAC,TAT	Y81Y	XP_011525739.1

Gene: NAPA-AS1
Gene Name: NAPA antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details